Main Introduction Page Electronic Reference Library Know-how Glossary of acronyms and other terms used on this website A Catalog of the Butterflies of the United States and Canada Illustrated Checklist of Neotropical Butterflies Support the Butterflies of America Foundation Interactive Listing of American Butterflies Photographer Credits Learn about contributing your photos Citation for this website Contact us
Papilionidae (Swallowtails)Pieridae (Whites and Sulphurs)Lycaenidae (Gossamerwings)Riodinidae (Metalmarks)Nymphalidae (Brushfoots)Hesperiidae (Skippers)Links to external lepidoptera websites
Loading

Porphyrogenes peterwegei Burns, 2010
(Peter's Scarlet-eye)

Type Specimens
photo collection Page 1:

Type Specimens
photo collection Page 2:

Pinned Specimens
photo collection:

Immatures photo collection
Page 1:

Immatures photo collection
Page 2:

Larval Foodplants
photo collection:

Genitalia photo collection:

Distribution and Larval Foodplants:

Northwestern Costa Rica, recorded from the Area de Conservación Guanacaste (Prov. Alajuela) rainforests between 95m and 760m and scarcely between the rain forest and dry forest, and Estación Quebrada Bonita (near Jaco, Prov. Puntarenas).

Larval foodplants: Machaerium acuminatumfalciforme, floribundum, kegelii, salvadorense, seemannii, Machaerium sp. (Fabaceae), and Dichapetalum morenoi (Dichapetalaceae), but mostly on Machaerium seemannii.
 

Diagnosis

P. perewegei differs from described Porphyrogenes species by the absence of distal small white macules, thus having only a single, and very large, white macule in the middle of the forewing in females, and a unique combination of whitish (not brown) fringes with dark brown (not purplish black) ground color, tawny tufts at the base of dorsal hindwing and prominent (not barely defined) tornal lobe on the hindwing in males.

 

Synonymy

 

Porphyrogenes peterwegei Burns, 2010

Proc. Ent. Soc. Wash. 112(1): 34, figs. 1 ♂ D, 2 ♂ V; 3 ♀ D, 4 ♀ V (holotype); 5 ♂ tegumen and uncus, 6 ♂ genitalia; 7 ♀ V, 8 ♀ L genitalia; 9 D, 10 L larva 2nd instar; 11 D, 12 DL larva 3rd instar, 13 D, 14 DL larva 4th instar; 15, 16 DL larva 5th (last) instar; 17 pupal shelter; 18 F, 19 D, 20 L pupa;  .

Original Combination: Porphyrogenes peterwegei

Type Locality: “Rio Blanco Abajo, Sector San Cristobal, Area de Conservación Guanacaste, Alajuela, Costa Rica, 500 m, latitude 10.90037, longitude -85.37254“

Types: Holotype in USNM.

 

Bibliography

Original description from:

Burns, John McLauren, Daniel H. Janzen, and Winifred Hallwachs 2010. Of many similar species in the Neotropical genus Porphyrogenes (Lepidoptera: Hesperiidae), a new one, repeatedly reared in Costa Rica, is relatively distinct. Proceedings of the entomological Society of Washington 112(1): 32-42, 20 figs., 1 tab.

p. 34-39, f. 1-20

Porphyrogenes peterwegei Burns,
new species

Diagnosis.—Females of Porphyro-  
genes always have one or more fore-  
wing spots (joined, in some species, to  
form a transverse band), whereas males  
(except for two species) are spotless.  
The female of P. peterwegei is unique in  
having only one spot—an outsized one  
in the center of the forewing (in cell  
CuA1-CuA2) (Figs. 3–4). Although  
females of a few other species have a  
similar large central spot, they also have  
a small distal spot (in cell M3-CuA1)  
(see figures in Austin and Mielke 2008).  
The male of P. peterwegei shares  
whitish wing fringes (Figs. 1–2) with  
just one other species, P. stupa Evans,  
which is known from a single dataless  
male whose ground color is virtually  
black with a purplish sheen, instead of  
dark brown as in P. peterwegei, and  
whose hind wing is broad, rounded, and  
lacking a tornal lobe, while that of P.  
peterwegei is narrow with a prominent  
tornal lobe.

Description.—Size: Females average  
larger than males. Forewing length in  
mm: Male: Mean = 22.93, SD = 0.982,  
n=45, Range 21.0–24.7. Female: Mean  
= 25.77, SD = 1.378, n = 51, Range  
23.0–28.5. NB: Owing to the unnatural  
and inferior conditions of rearing,  
reared adults average smaller than wild  
ones; the degree of dwarfing varies,  
especially with respect to the stage of  
the caterpillar when found. The three  
males and four females obtained from  
wild-caught pupae of this species are  
near or at the upper end of the size  
range, given above, for each sex.

Number of segments in nudum of  
antennal club: The sexes do not differ.  
Mean = 29.96, SD = 1.259, n = 76,  
Range 27–34. The number of nudum  
segments is not correlated with length  
of the forewing.

Wing shape (Figs. 1–4): Sexual  
dimorphism pronounced. Wings of  
male narrow and apically pointed; those  
of female broad and apically rounded.  
In both sexes, hind wing tornus con-  
spicuously lobed.

Facies: Sexual dimorphism extreme.  
Male (Figs. 1–2): Body and wings dark  
brown both dorsally and ventrally, but  
dorsally conspicuously overscaled with  
dull orange on body and on about  
proximal half of forewing and proximal  
two-thirds of hind wing. Fringe along  
outer margin of both wings narrowly  
edged off-white. Hind wing with faintly  
suggested postmedian band of small,  
darker brown spots (more detectable  
ventrally than dorsally). Legs dull  
orange. Female (Figs. 3–4): Body and  
wings grayish brown dorsally and  
especially ventrally, with one huge,  
elliptical, hyaline spot in middle of  
forewing in cell CuA1-CuA2. Dorsal  
overscaling faint greenish gray; pur-  
plish sheen distal to this overscaling,  
primarily on forewing (visible when  
viewed at certain angles). Edge of  
fringe along outer margin not distinc-  
tively off-white (as in male), but often  
(though variably) paler than ground  
color, especially above tornal lobe.  
Hind wing postmedian band of darker  
spots more evident than in male,  
especially ventrally. More or less con-  
spicuous pale gray, submarginal to  
marginal strip (interrupted by darker  
veins) distal to ventral hind wing  
spotband and contrasting with it. Sim-  
ilar marginal strip of still paler gray on  
ventral forewing. All of ventral fore-  
wing space between vein 2A and inner  
margin extra pale. Legs dull orange.

Secondary sex characters: Male:  
Forewing with costal fold. Forewing  
vein 2A bowed anteriad and, along  
highest reaches of its arc, swollen and  
ventrally devoid of scales; vein 2A,  
from swollen stretch to base of wing,  
bisecting ventral speculum comprising  
variously modified scales. On dorsal  
hind wing, two conspicuous, adjacent,  
distally light-brown and proximally tan  
hair tufts arising near base of cell  
Sc+R1-Rs and near base of discal cell,  
and associated with large speculum  
extending from discal cell to costa.  
Both sexes: Ventral hind wing with  
deep, pale-scaled groove (most promi-  
nent proximally) in cell 2A-3A.

Genitalia: Male (Figs. 5–6): In  
lateral view, body of valva (i.e., anterior  
two-thirds) low; distal one-third of  
valva (= harpe) robust (i.e., not notably  
narrower than adjacent part of body)  
and abruptly bent dorsad, nearly or  
quite forming right angle with body,  
then terminating in large, sharp, ante-  
rodorsal point and bearing some preter-  
minal coarse teeth. Cornuti long, essen-  
tially  straight,  delicate  spines  
(numbering 31, 31, 32, 32, 34 [see  
Fig. 6], and 36 in six individuals); in  
everted vesica, rather evenly and widely  
spaced, except for some relatively  
clustered proximal ones. Tegumen  
stocky; its delicate posterior prongs  
uneven in diameter, about as in Figs.  
5–6 (or, in extreme case, so uneven as  
to suggest linked sausages). Uncus, in  
dorsal view, a wide U, evenly curved at  
bottom. Female (Figs. 7–8): Well-scler-  
otized sterigma surrounding midventral,  
paler, usually membranous area at, and  
posterior to, ostium bursae. Central part  
of lamella antevaginalis with conspicu-  
ous posterior edge forming sill of  
ostium bursae. Wrinkled membrane  
ventral to sterigma with exaggerated  
wrinkling laterally and sclerotized plate  
midventrally; sclerotized plate same  
width as central part of lamella ante-  
vaginalis (and directly beneath it) but  
extending farther posteriad. Posterior  
edge of lamella postvaginalis thickened,  
darkly sclerotized, midventrally V-  
shaped, and prominently hirsute around  
V. Membrane of posterior 40% of  
corpus bursae with limited, longitudinal  
sclerotization suggesting trough or ca-  
noe.

Ecological distribution: Known from  
ACG rainforest habitats between 95 m  
and 760 m. Present but scarce in  
intergrade between ACG rain forest  
and dry forest.

Larval foodplants (Table 1): Diet  
very restricted. Total of 213 caterpillars  
found feeding on seven species of  
Machaerium (Fabaceae, Fabales)—  
mainly M. seemannii Benth. and M.  
acuminatum Kunth—but 14 caterpillars  
found feeding on Dichapetalum mor-  
enoi Prance (Dichapetalaceae, Malpigh-  
iales).

Developmental times: In the rainforest  
environment, the duration of larval  
development (first through fifth instar)  
ranges from 90 to 100 days. Pupal  
development lasts 16 to 30 days. There  
is no evidence of pupal dormancy.

Type material.—Holotype: female  
(Figs. 3–4), voucher code 03-SRNP-  
6133, Rio Blanco Abajo, Sector San  
Cristobal, Area de Conservacin Gua-  
nacaste, Alajuela, Costa Rica, 500 m,  
latitude 10.90037, longitude -85.37254  
(USNM), collector Carolina Cano. Yel-  
low label reads "LEGS AWAY/FOR  
DNA." DNA barcode: AACCTTATATT  
TTATTTTTGGAATCTGAGCAGGAA  
TAGTAGGAACTTCTCTAAGATTAC  
TAATTCGAACTGAATTAGGAACC  
CCCGGATCTTTAATTGGAGATGAC  
CAAATTTATAATACTATTGTTACA  
GCTCATGCTTTTATTATAATTTT  
CTTTATAGTTATACCTATTATAAT  
TGGAGGTTTTGGAAATTGACTAG  
TTCCTTTAATACTGGGAGCTCCTG  
ATATAGCATTCCCCCGAATAAATA  
ATATAAGATTTTGATTATTACCCC  
CTTCTTTAACTCTTTTAATTTCAAG  
AAGAATTGTAGAAAATGGTGCAG  
GTACAGGTTGAACTGTATACCCC  
CCTTTATCATCAAATATTGCTCATC  
AAGGATCTTCTGTTGATTTAGC  
AATCTTTTCTCTACATCTTGCAGG  
TATTTCTTCAATTTTAGGAGCTATT  
AATTTTATTACTACAATTATTAATAT  
ACGAATTAACAATTTATCTTTTGA  
CCAAATACCTCTATTTGTTTGAGC  
AGTAGGAATTACAGCTTTATTATTA  
TTATTATCATTACCAGTTTTAGCTG  
GTGCAATTACTATACTTTTAACTGA  
TCGAAATTTAAATACTTCATTTTTT  
GATCCTGCTGGAGGAGGTGATCCT  
ATTTTATC.

Paratypes: 45 males, 50 females,  
ACG, Costa Rica (USNM). For more  
detail, see Janzen and Hallwachs  
(2009).

Etymology.—This skipper is named  
in honor of Peter Wege of Grand  
Rapids, Michigan, whose extraordinary  
generosity has (1) significantly in-  
creased the size of ACG and perma  
nently secured thousands of hectares of  
P. peterwegei rainforest habitat, (2)  
stimulated conservation overall by sup-  
porting the founding of the Costa Rican  
Ministry of Environment and Energy in  
1986–1990, and (3) advanced the mis-  
sion and deeds of DNA barcoding.

Text  from:

Austin, George T., and Olaf Hermann Hendrik Mielke 2008. Hesperiidae of Rondônia, Brazil: Porphyrogenes Watson (Lepidoptera: Pyrginae: Eudamini), with descriptions of new species from Central and South America. Insecta Mundi 0044: 1-56, 165 figs. (26 September 2008)

p. 29-30, f. 83, 84, 152

Porphyrogenes undescribed species

(Fig. 83, 84, 152)

      An extensive  series of  a species  of Porphyrogenes  (to be subsequently named and described) from

northwestern Costa Rica was reared from early stages (Janzen and Hallwachs 2008). Males of this species

have  a dark brown  dorsum with  extensive tawny-orange  overscaling basad,  tawny tufts of the hindwing,

and  a virtually unmarked  dark brown  venter (Fig. 83, 84).  Females  are gray-brown  with  a single  large

white  trapezoidal  macule  in CuA1-CuA2  on the  forewing.  The species  is recognized  by its  prominently

whitish  fringes,  a character  not observed  on other Porphyrogenes with  the exception of the very darkly

colored  P. stupa.  Genitalia (Fig. 152) of an apparent male  of this species are similar to those of P. zohra

(specimen  from COSTA RICA:  Ciudad Colon, September, GTA #13917).

Comment: According to Burns, Janzen and Hallwachs (2010), specimen illustrated on f. 83, 84, 152 is not this species, and we treat this specimen as an undescribed taxon Porphyrogenes sp.



Additional texts from:

Burns, John McLauren, Daniel H. Janzen, and Winifred Hallwachs 2010. Of many similar species in the Neotropical genus Porphyrogenes (Lepidoptera: Hesperiidae), a new one, repeatedly reared in Costa Rica, is relatively distinct. Proceedings of the entomological Society of Washington 112(1): 32-42, 20 figs., 1 tab.

p. 32

     Abstract.—Associating   sexes  in  many  species  of  the  Neotropical  hesperiid
genus  Porphyrogenes  has been difficult,  erroneous,  or impossible, owing to their
sexual  dimorphism.  Despite  the extreme  sexual  dimorphism of  Porphyrogenes
peterwegei  Burns,  new  species,  full description  of this rainforest skipper from
Area de Conservación Guanacaste (ACG), northwestern Costa Rica, is no problem.
The  available  sample amounts  to nearly 100  reared adults, almost evenly divided
between  the  sexes.  Of  these,  67  have  been  DNA  barcoded  and  found  to vary
minimally in their COI haplotypes, with one haplotype predominating.  Caterpillars
and pupae  consistently  go through  a distinctive  set of  developmental  changes in
their  color patterns.  Foodplant choice is conservative: of 227 immatures found in
the wild,  94% were  eating woody  vines of the  genus Machaerium, especially M.
seemannii  (Fabaceae),  whereas  6%  were  feeding  on the quite  unrelated species
Dichapetalum morenoi  (Dichapetalaceae)—a peculiar pattern  of larval foodplant
selection  seen in another skipper and two butterfly species in ACG. Caterpillars of
P.   peterwegei   are   occasionally   attacked   by   a   host-specific   parasitoid   (an
undescribed  tachinid  of  the genus  Siphosturmia),  which  has not otherwise been
encountered  in  20,642  tachinid  attacks  on the caterpillars  of  >3,000 species of
Lepidoptera in ACG.  Morphologically, P. peterwegei differs significantly from its
many  congeners  in both  facies  and genitalia.

p. 41

     In  a  brief  account  of  P.  peterwegei
under  the  heading  "Porphyrogenes  un-
described  species,"  Austin   and   Mielke
(2008)  refer  to  the "genitalia (Fig. 152)
of   an   apparent   male   of  this  species"
from  Finca  Hamadryas,  Ciudad  Colon,
Costa  Rica,  15 September 1998, dissec-
tion  GTA   #   13917.   The genitalia   in
figure 152 are not those of P. peterwegei
(they    may   be    those   of   yet   another
undescribed  species  of Porphyrogenes),
and   figures  83  and   84  in  Austin  and
Mielke  (2008)  show  dorsal  and ventral
facies  of  this  misdetermined individual.

 

References:

Austin, George T., and Olaf Hermann Hendrik Mielke 2008. Hesperiidae of Rondônia, Brazil: Porphyrogenes Watson (Lepidoptera: Pyrginae: Eudamini), with descriptions of new species from Central and South America. Insecta Mundi 0044: 1-56, 165 figs. (26 September 2008)

Burns, John McLauren, Daniel H. Janzen, and Winifred Hallwachs 2010. Of many similar species in the Neotropical genus Porphyrogenes (Lepidoptera: Hesperiidae), a new one, repeatedly reared in Costa Rica, is relatively distinct. Proceedings of the entomological Society of Washington 112(1): 32-42, 20 figs., 1 tab.

Top of PageMain PageReference LibraryLiterature ListCitationInteractive Listing

This website is supported by Butterflies of America Foundation, a U.S. registered 501(c)(3) tax-deductible nonprofit 170(b)(1)(A)(vi) public charity.